Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC156A

[Submit comment/correction]

Locus	ABC156A
Type	RFLP
Synonym	Synonym ABC156
Chromosome	2H 5H
Map	Barley-consensus-2003-5H 27.9 [ Show all 13 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QMe.DiMo-2H
Map Data	[ Hide all but 1 of 13 ] Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, Steptoe x Morex, SSAP Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Probe	ABC156
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABC156A in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	ABC156 [ Show all 23 ]
Probe for Locus	ABC156
Locus	Sr33 [ Show all 25 ]
Synonym	Synonym HAR35_37808
General Remarks	Steptoe malt cDNA
Type	cDNA STS
STS primers	5' TTACGGGATCAAAGCTGAGGC 5' GACAAGCAACACCAACCAAGC
STS size	197
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	BQ548054 ABC156 ABC156-5
Polymorphism	ABC156 XbaI ABC156 EcoRI ABC156 EcoRV ABC156 HindIII ABC156 DraI
Linkage Group	Groups 2,3,1 2 3
Source Species	Hordeum vulgare
Source Germplasm	Steptoe (barley)
Source Tissue	malt
Insert Size	0.3