Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC163

[Submit comment/correction]

Locus	ABC163
Type	RFLP
Synonym	Synonym ABC163
Chromosome	6H
Chromosome Arm	6HL
Map	Barley-consensus-2003-6H 58.3 [ Show all 16 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QGms.HaTR-6H
Map Data	[ Hide all but 1 of 18 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, GxH Barley, HxT Barley, HxT basemap Barley, Integrated, Marcel 2009 Barley, IxF Barley, Steptoe x Morex, SNP Barley, SxM Barley, SxM, Feed QTLs Barley, Zhedar2, FHB QTL
Probe	ABC163
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABC163 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	ABC163A ABC163B Xabc163 Xabc163-6A
Probe	ABC163
Locus	ABC163B [ Show all 7 ]
Synonym	Synonym HAR35_15282
Remarks	Steptoe malt cDNA
Type	cDNA STS
STS primers	5' TTACGGGATCAAAGCTGAGGC 5' TGGCAGCGCTGTTGTAGGTT
STS size	252
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	BQ548055 ABC163-5
Linkage Group	Group 6
Source Species	Hordeum vulgare
Insert Size	0.3