Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC252

[Submit comment/correction]

Locus	ABC252
Type	RFLP
Synonym	Synonym ABC252
Chromosome	2H
Chromosome Arm	2HL
Map	[ Hide all but 1 of 21 ] Barley-Consensus-2H 51.6 Barley-Consensus2-2H 123.8 Barley-ConsensusFHB-2H 121.33 Hordeum-Bins-2H 138.7 Hordeum-Consensus2005-SNP-2H 123.014 Hordeum-Consensus2006-DArT-2H 131.5 Hordeum-Consensus2007-SSR-2H 123.04 Hordeum-FxS-FHB-QTL-2H 179.7 Hordeum-NABGMP1-2H 140.3 Hordeum-NABGMP2-2H 201.8 Hordeum-OPA-2009-2H 199.54 Hordeum-PilotOPA1-2H 129.528 Hordeum-QTLConsensus-Abiotic-2H 123.01 Hordeum-QTLConsensus-Agronomic-2H 123.01 Hordeum-StMo-SNP-2H 123.34 Hordeum-SxM-base-2H 136.3 Hordeum-SxM-FeedQTL-2H 140.3 Hordeum-SxM-SSAP-2H 139.2 Hordeum-SxM-SSR-2H 162.8 Hv-Consensus2006-Marcel-2H 123.04 Hv-Integrated2009-2H 120.2
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.DON_2H_26 [ Show all 8 ]
Map Data	Barley consensus [ Show all 21 ]
Species	Hordeum vulgare
Probe	ABC252
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 7 ]
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Number of populations contributing to the placement of ABC252 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABC252-2H
Probe	ABC252
Locus	ABC252 ABC252-2H
External Databases	DDBJ EMBL GenBank
Type	cDNA STS
PCR primers	CACAAGGCTCAAAACATAAC AAGCTCACCAAGTCCCAGTC
Sequence	L43937 ABC252
Linkage Group	2
Source Species	Hordeum vulgare
Insert Size	0.5