Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC254

[Submit comment/correction]

Locus	ABC254
Type	RFLP
Synonym	Synonym ABC254
Chromosome	5H 7H
Chromosome Arm	7HS
Map	Barley-consensus-2003-5H 95.7 [ Show all 12 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QNba-GaHa-5H
Map Data	[ Hide all but 1 of 14 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, Marcel Barley, GxH Barley, HxT Barley, Integrated, Marcel 2009 Barley, Steptoe x Morex, SNP Barley, SxM Barley, SxM, Feed QTLs
Probe	ABC254
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Langridge, Peter J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Probe	ABC254
Locus	ABC254
Synonym	Synonym HAR35_14835 HAR35_30381
External Databases	DDBJ EMBL GenBank
Type	cDNA STS
PCR primers	CTCACCACCGAGGCCAAGAA AAGAAAGCTGAAGGCACATT
Sequence	L43939 ABC254
Source Species	Hordeum vulgare