Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC255

[Submit comment/correction]

Locus	ABC255
Type	RFLP STS
Synonym	Synonym ABC255 POPA3_0880
Chromosome	7H
Chromosome Arm	7HS
Map	Barley-consensus-2003-7H 14.7 [ Show all 24 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.HD_7H_6
Map Data	[ Hide all but 1 of 24 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, AxK Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, CxH Barley, GxH Barley, GxHN, SFNB Barley, Integrated, Marcel 2009 Barley, OPA 2009, Consensus Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, Pilot OPA1, Consensus Barley, Steptoe x Morex, SNP Barley, SxM Barley, SxM, Feed QTLs
Species	Hordeum vulgare
Probe	ABC255
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19 Close, Timothy J. Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABC255 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	12_30880 ABC255-7H POPA3_0880 BOPA2_12_30880
Probe	ABC255
Locus	ABC255 ABC255-7H
Synonym	Synonym HAR35_14478 HAR35_14482 HAR35_14484
External Databases	DDBJ EMBL GenBank
Type	cDNA STS
PCR primers	GATCATCGTGGATGGAGTGT CGAATTCCGAGACATCAAAT
Sequence	L43940 ABC255
Source Species	Hordeum vulgare