Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC257

[Submit comment/correction]

Locus	ABC257
Type	RFLP
Synonym	Synonym ABC257
Chromosome	1H
Chromosome Arm	1HL
Map	[ Hide all but 1 of 19 ] Barley-Consensus-1H 75.3 Barley-Consensus2-1H 120.9 Barley-ConsensusFHB-1H 117.9 Hordeum-Bins-1H 125.3 Hordeum-Consensus2005-SNP-1H 118.873 Hordeum-Consensus2006-DArT-1H 112 Hordeum-Consensus2007-SSR-1H 106.92 Hordeum-Genes-1H -31.6 Hordeum-KxM-1H 142 Hordeum-NABGMP1-1H 116.9 Hordeum-QTLConsensus-Abiotic-1H 118.87 Hordeum-QTLConsensus-Agronomic-1H 118.87 Hordeum-StMo-SNP-1H 126.58 Hordeum-SxM-base-1H 117.5 Hordeum-SxM-FeedQTL-1H 116.9 Hordeum-SxM-SSAP-1H 113.9 Hordeum-SxM-SSR-1H 125.1 Hv-Consensus2006-Marcel-1H 106.92 Hv-Integrated2009-1H 108.6
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 19 ]
Species	Hordeum vulgare
Probe	ABC257
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of ABC257 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	Xabc257
Probe	ABC257
Locus	ABC257 RI031O17 Xabc257
Synonym	Synonym HAR35_12802 HAR35_48951
External Databases	DDBJ EMBL GenBank
Type	cDNA STS
PCR primers	TTCAACGAAAACTCTGTCCA GACGCCAGAGCTAGCAAAGT
Sequence	L43941 ABC257
Source Species	Hordeum vulgare