Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC302

[Submit comment/correction]

Locus	ABC302
Type	RFLP
Synonym	Synonym ABC302 ABC302A
Chromosome	5H
Chromosome Arm	5HL
Map	Barley-Consensus-5H 16.9 [ Show all 27 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	[ Hide all but 1 of 8 ] MetaQ.DON_5H_2 MetaQ.HT_5H_3 MetaQ.HT_5H_4 QABA.StMo-5H QBgsg.StMo-5H QBgsk.StMo-5H QBgsk.StMo-5H.1 QGms.StMo-5H.1
Map Data	Barley consensus [ Show all 27 ]
Species	Hordeum vulgare
Probe	ABC302 Kaveh H et al. (1968) Allelic and linkage relations among genes for reaction to wheat stem rust. Agronomy Abstracts 12.
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 8 ]
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of ABC302 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABC302-5H ABC302A ABC302B
Probe	ABC302
Locus	ABC302 ABC302B ABC302A ABC302-5H
Synonym	Synonym HAR35_14926
Remarks	Steptoe malt cDNA
Type	cDNA STS
STS primers	5' CTGGTGCTTTCGATGCTGT 5' CTGAGTCTTCGCCATGCATA
STS size	ca. 1100
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	BQ548063 BQ548062 ABC302 ABC302-5 ABC302-3
Linkage Group	Group 7
Source Species	Hordeum vulgare
Insert Size	0.8