Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG20

[Submit comment/correction]

Locus	ABG20
Type	RFLP
Synonym	Synonym ABG020
Chromosome	6H
Chromosome Arm	6HS
Map	Barley-Consensus-6H 0 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 9 ]
Probe	ABG20
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Number of populations contributing to the placement of ABG20 in the Barley, Consensus 2006 DArT maps = 1 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	ABG020 [ Show all 8 ]
Probe	ABG20
Locus	[ Hide all but 1 of 13 ] ABG20 Xabg20-6 Xabg20-6D RI037K8 RI001G12 RI022O9 D1.1_ctg5362 Xabg20 ABG020 pabg20 ABG020.1 abg20 abg20-6D
Remarks	Shin Ebisu16 gDNA
Type	Genomic STS
STS primers	5' GGCAACCGCAAGAAAGAAAG 5' CCTCTCATGTCAGAGCATTT
STS size	254
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	L43971 ABG20 ABG20-5 ABG20-3
Linkage Group	Group 6
Source Species	Hordeum vulgare
Insert Size	1.3