Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG319d

[Submit comment/correction]

Locus	ABG319d
Type	RFLP
Chromosome	7H
Map	Hordeum-Bins-7H 78 Hordeum-Graner2-7H 110.2 Hv-Consensus2006-Marcel-7H 77.76 Hv-Integrated2009-7H 76.5
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF
Probe	ABG319
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	ABG319 [ Show all 8 ]
Probe for Locus	ABG319
Locus	[ Hide all but 1 of 9 ] Xabg319-3 ABG319e ABG319d ABG319A ABG319B ABG319C ABG319a-4H ABG319c-4H ABG319
Synonym	Please see p13XB(2.4) Synonym HAR35_31000 HAR35_4386 HAR35_904
External Databases	DDBJ EMBL GenBank
Type	STS
PCR primers	TTTCCTTTTCCAATTGTGTG CGGACAACAGCAGCTCTCAC
Sequence	L43978 ABG319
Source Species	Hordeum vulgare