Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG358

[Submit comment/correction]

Locus	ABG358
Type	RFLP
Synonym	Synonym ABG358
Chromosome	2H
Chromosome Arm	2HS
Map	Barley-Consensus-2H -25.7 [ Show all 21 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 21 ]
Species	Hordeum vulgare
Probe	ABG358
Reference	[ Hide all but 1 of 6 ] Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Number of populations contributing to the placement of ABG358 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABG358-2H
Probe	ABG358
Locus	ABG358 ABG358-2H
Synonym	Synonym HAR35_4004
Reference	Kleinhofs A et al. (1993) A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome Theoretical and Applied Genetics 86:705-712.
Remarks	Shin Ebisu16 gDNA
Type	Genomic STS
STS primers	5' ATTCCAGAACCTCCTCGAC 5' AAGCCACATCAACATAATGC
STS size	150
Amplification Conditions	STS annealing temperature 50-52 oC
Sequence	L43981 ABG358 ABG358-5
Linkage Group	2S 2
Source Species	Hordeum vulgare
Source Germplasm	Shin Ebisu 16
Insert Size	0.4