Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG388

Locus	ABG388
Type	CAPS RFLP
Synonym	Synonym ABG388
Chromosome	6H
Chromosome Arm	6HL
Map	[ Hide all but 1 of 19 ] Barley-Consensus-6H 5.6 Barley-Consensus2-6H 70.4 Hordeum-Bins-6H 78.6 Hordeum-Consensus2005-SNP-6H 81.368 Hordeum-Graner2-6H 70.5 Hordeum-NABGMP1-6H 68 Hordeum-OWB-2004-6H 87.6 Hordeum-OWB-2005-6H 91.7 Hordeum-OWB-6H 93.8 Hordeum-OWB-OPA2008-6H 86.393 Hordeum-OWB-SNP-6H 93.11 Hordeum-QTLConsensus-Abiotic-6H 81.37 Hordeum-QTLConsensus-Agronomic-6H 81.37 Hordeum-RxK-NTNB-6H 98 Hordeum-StMo-SNP-6H 72.34 Hordeum-SxM-FeedQTL-6H 68 Hv-Consensus2006-Marcel-6H 72.4 Hv-Integrated2009-6H 72.2 Hv-L94/Vada-2006-6H 74.48
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 19 ]
Species	Hordeum vulgare
Probe	ABG388
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Steptoe x Morex; Igri x Franka
Possible Orthologs	ABG388-6H Xabg388 Xabg388-6A
Probe	ABG388
Locus	ABG388 Xabg388-6A RI026L17 Xabg388 ABG388-6H
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
Remarks	Restriction Enzyme for CAPS marker is Nla III
Type	Genomic STS
STS primers	5' GCACTGGCATAGTCTCACAA 5' CGATGCTGGTTCGGTCATAC
STS size	303
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 58 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	BH854354 BH854353 ABG388-5 ABG388-3
Source Species	Hordeum vulgare