Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG390

[Submit comment/correction]

Locus	ABG390
Type	RFLP
Synonym	Synonym ABG390
Chromosome	5H
Chromosome Arm	5HL
Map	Barley-consensus-2003-5H 79.5 [ Show all 21 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QDrm.StMo-5H.2
Map Data	Barley consensus [ Show all 21 ]
Species	Hordeum vulgare
Probe	ABG390
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19 Close, Timothy J. Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABG390 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABG390-5H Xabg390 Xabg390-3A Xabg390-4A
Probe	ABG390
Locus	[ Hide all but 1 of 7 ] ABG390 Xabg390-4A HI083F21 HD083F21 Xabg390-3A Xabg390 ABG390-5H
Synonym	Synonym HAR35_10233
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	AACACAACCACAATAAAGAA TTTGAACAGAAGAAAACCTA
STS primers	5' TGTTCCCAGCATTTGAACAG 5' CGGCAATCCTAATTTTTGGA
STS size	357
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	L43988 ABG390 ABG390-5
Source Species	Hordeum vulgare