Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG391

[Submit comment/correction]

Locus	ABG391
Type	RFLP STS
Synonym	Synonym ABG391
Chromosome	5H
Chromosome Arm	5HL
Map	[ Hide all but 1 of 32 ] Barley-consensus-2003-5H 66.8 Barley-Consensus-5H 99.5 Barley-Consensus2-5H 171.3 Barley-ConsensusFHB-5H 173.1 Hordeum-AxK-5H 126.7 Hordeum-Bins-5H 175.4 Hordeum-Consensus2005-SNP-5H 171.684 Hordeum-Consensus2006-DArT-5H 169.4 Hordeum-Consensus2007-SSR-5H 156.31 Hordeum-CxH-5H 202.23 Hordeum-DxM-5H 185.2 Hordeum-DxM-Dnh-5H 177.5 Hordeum-FxS-FHB-QTL-5H 227 Hordeum-Graner2-5H 186.3 Hordeum-GxH-5H 247.71 Hordeum-IxF-SSR-5H 181.4 Hordeum-NABGMP1-5H 178.4 Hordeum-OWB-2004-5H 191.6 Hordeum-OWB-2005-5H 197.3 Hordeum-OWB-5H 182.8 Hordeum-OWB-OPA2008-5H 216.016 Hordeum-OWB-SNP-5H 154.13 Hordeum-Physical-RFLP-5H 237.2 Hordeum-QTLConsensus-Abiotic-5H 171.68 Hordeum-QTLConsensus-Agronomic-5H 171.68 Hordeum-StMo-SNP-5H 160.95 Hordeum-SxM-base-5H 177.6 Hordeum-SxM-FeedQTL-5H 178.4 Hordeum-SxM-SSAP-5H 164.5 Hordeum-SxM-SSR-5H 192.5 Hv-Consensus2006-Marcel-5H 156.31 Hv-Integrated2009-5H 153.5
	[ Show Nearby Loci ]
QTL with Locus Marker	QMe.DiMo-5H.3
Map Data	Barley consensus [ Show all 32 ]
Species	Hordeum vulgare
Probe	ABG391
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. [ Show all 8 ]
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABG391 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABG391-5H Xabg391 Xabg391-5A abg391 abg391-5A
Probe	ABG391
Locus	ABG391 [ Show all 6 ]
Synonym	Synonym HAR35_10560
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	CGGTGAATTCCGTGCATTT CATCAAACTCAATGCAAGTG
STS primers	5' GCAAGTGCACTGCTGTACAA 5' TGTTCTCGTACCATGACTTC
STS size	ca. 800
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	L43989 ABG391 ABG391-5 ABG391-3
Source Species	Hordeum vulgare