Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG391

[Submit comment/correction]

Locus	ABG391
Type	RFLP STS
Synonym	Synonym ABG391
Chromosome	5H
Chromosome Arm	5HL
Map	Barley-consensus-2003-5H 66.8 [ Show all 32 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QMe.DiMo-5H.3
Map Data	[ Hide all but 1 of 32 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, AxK Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, CxH Barley, Dicktoo x Morex Barley, DxM, Dhn genes Barley, FxS, FHB QTL Barley, GxH Barley, Igri x Franka, SSR Barley, Integrated, Marcel 2009 Barley, IxF Barley, OWB Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP Barley, physical Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, Steptoe x Morex, SSR Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Species	Hordeum vulgare
Probe	ABG391
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. [ Show all 8 ]
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABG391 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABG391-5H Xabg391 Xabg391-5A abg391 abg391-5A
Probe	ABG391
Locus	ABG391 [ Show all 6 ]
Synonym	Synonym HAR35_10560
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	CGGTGAATTCCGTGCATTT CATCAAACTCAATGCAAGTG
STS primers	5' GCAAGTGCACTGCTGTACAA 5' TGTTCTCGTACCATGACTTC
STS size	ca. 800
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	L43989 ABG391 ABG391-5 ABG391-3
Source Species	Hordeum vulgare