Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG398

[Submit comment/correction]

Locus	ABG398
Type	RFLP
Synonym	Synonym ABG398
Chromosome	3H
Chromosome Arm	3HS
Map	[ Hide all but 1 of 11 ] Barley-Consensus-3H -0.4 Barley-Consensus2-3H 40.5 Hordeum-Bins-3H 60 Hordeum-Consensus2005-SNP-3H 50.65 Hordeum-NABGMP1-3H 75.3 Hordeum-QTLConsensus-Abiotic-3H 50.65 Hordeum-QTLConsensus-Agronomic-3H 50.65 Hordeum-StMo-SNP-3H 49.1 Hordeum-SxM-FeedQTL-3H 75.3 Hv-Consensus2006-Marcel-3H 48.42 Hv-Integrated2009-3H 60
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 11 ]
Probe	ABG398
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	Xabg398-3
Probe	ABG398
Locus	Xabg398-3 ABG398
Synonym	Synonym HAR35_16766
External Databases	DDBJ EMBL GenBank
Reference	Kleinhofs A et al. (1993) A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome Theoretical and Applied Genetics 86:705-712.
Type	Genomic STS
PCR primers	AAGTGATGGAATTCAGAAAG AAGCGGTTCCTTTTGTTACT
Sequence	L43992 ABG398
Linkage Group	3
Source Species	Hordeum vulgare
Source Germplasm	Shin Ebisu 16
Insert Size	0.4