Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG453

[Submit comment/correction]

Locus	ABG453
Type	RFLP
Synonym	Synonym ABG453
Chromosome	2H 3H
Chromosome Arm	3HL
Map	Barley-consensus-2003-2H 52.7 [ Show all 23 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QGms.StMo-3H QHd.StMo-3H.2 QHt.HaMo-3H.4 QYld.HaMo-3H
Map Data	[ Hide all but 1 of 23 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Cali-sib x BowmanBC, QTL Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, CxH Barley, Integrated, Marcel 2009 Barley, IxF Barley, KxM Barley, OPA 2009, Consensus Barley, Pilot OPA1, Consensus Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Species	Hordeum vulgare
Probe	ABG453
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19 Close, Timothy J. Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABG453 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABG453-3H Xabg453-3
Probe	ABG453
Locus	ABG453 Xabg453-3 ABG453-3H
Remarks	Shin Ebisu16 gDNA
Type	Genomic STS
STS primers	5' GCTATTGACAAGCAATGCC 5' GGTGACGTAGCACGCACTAA
STS size	ca. 1000
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	BH854357 BH854356 ABG453-5 ABG453-3
Linkage Group	Group 3
Source Species	Hordeum vulgare
Insert Size	1.1