Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG458

[Submit comment/correction]

Locus	ABG458
Type	CAPS RFLP
Synonym	Synonym ABG458
Chromosome	6H
Chromosome Arm	6HS
Map	[ Hide all but 1 of 25 ] Barley-consensus-2003-6H 75.5 Barley-Consensus-6H -7.2 Barley-Consensus2-6H 56.8 Barley-ConsensusFHB-6H 54.5 Hordeum-Bins-6H 61.9 Hordeum-Consensus2005-SNP-6H 64.989 Hordeum-Consensus2006-DArT-6H 60.1 Hordeum-CxB-6H 52 Hordeum-Graner2-6H 58.6 Hordeum-GxH-6H 67.07 Hordeum-HxM-base-6H 39.2 Hordeum-IxF-SSR-6H 63.3 Hordeum-KxM-6H 54 Hordeum-NABGMP1-6H 47.8 Hordeum-OWB-2004-6H 49.7 Hordeum-OWB-6H 54.5 Hordeum-OWB-SNP-6H 54.83 Hordeum-QTLConsensus-Abiotic-6H 64.99 Hordeum-QTLConsensus-Agronomic-6H 64.99 Hordeum-RxK-NTNB-6H 77 Hordeum-StMo-SNP-6H 56.57 Hordeum-SxM-base-6H 60.6 Hordeum-SxM-FeedQTL-6H 47.8 Hordeum-SxM-SSAP-6H 58.2 Hordeum-SxM-SSR-6H 66.5
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_6H_5 MetaQ.FHB_6H_6 QSsg.StMo-6H
Map Data	Barley consensus [ Show all 25 ]
Species	Hordeum vulgare
Probe	ABG458
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABG458 in the Barley, Consensus 2006 DArT maps = 2
Possible Orthologs	ABG458-6H [ Show all 7 ]
Probe	ABG458
Locus	ABG458 [ Show all 6 ]
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
Remarks	Restriction enzyme informative in CAP analysis is RsaI Shin Ebisu16 gDNA
Type	Genomic STS
STS primers	5' GAGAGCCGATGACGGTATGT 5' CTTGGACACATGCCATATCC
STS size	248
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	L43996 ABG458 ABG458-5
Linkage Group	6S
Source Species	Hordeum vulgare
Insert Size	0.4