Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG500b

[Submit comment/correction]

Locus	ABG500b
Type	RFLP
Synonym	Synonym ABG500
Chromosome	4H
Map	[ Hide all but 1 of 16 ] Barley-Consensus2-4H 94.5 Hordeum-Bins-4H 97.1 Hordeum-Consensus2005-SNP-4H 94.703 Hordeum-Consensus2006-DArT-4H 116.1 Hordeum-Graner2-4H 105.1 Hordeum-IxF-SSR-4H 110.1 Hordeum-NABGMP1-4H 118.3 Hordeum-QTLConsensus-Abiotic-4H 94.7 Hordeum-QTLConsensus-Agronomic-4H 94.7 Hordeum-StMo-SNP-4H 94.9 Hordeum-SxM-base-4H 119.5 Hordeum-SxM-FeedQTL-4H 118.3 Hordeum-SxM-SSAP-4H 99.8 Hordeum-SxM-SSR-4H 119.9 Hv-Consensus2006-Marcel-4H 98.12 Hv-Integrated2009-4H 108.6
	[ Show Nearby Loci ]
QTL with Locus Marker	QGpc.StMo-4H QLg.StMo-4H
Map Data	Barley consensus 2 [ Show all 16 ]
Probe	ABG500
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of ABG500B in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	ABG500 ABG500A ABG500a-1H ABG500b-4H Xabg500
Probe for Locus	ABG500
Locus	ABG500A [ Show all 6 ]
Synonym	Synonym HAR35_26354
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	GCTAGAACTTGACCAATCTC AAGAAGAACCCGGAGAATCT
STS primers	5' ATTAATCCGACCGTCACTGC 5' ACGAACTCCTCGCTGCC
STS size	189
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AF309360 L44037 ABG500 ABG500-5
Source Species	Hordeum vulgare