Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG53

[Submit comment/correction]

Locus	ABG53
Type	RFLP
Synonym	Synonym ABG053
Chromosome	1H
Chromosome Arm	1HS
Map	Barley-Consensus-1H -4.4 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 6 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Consensus 2006, Marcel Barley, CxH Barley, Steptoe x Morex, SNP
Probe	ABG53
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Langridge, Peter J.
Remark	Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	ABG053
Probe	ABG53
Locus	ABG053 ABG53
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	TAATTGCATGAGTCTGAATC ACTTAAAATAGTCCGCACTG
Sequence	AF309355 L44038 ABG53
Source Species	Hordeum vulgare