Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG59

[Submit comment/correction]

Locus	ABG59
Type	RFLP
Synonym	Synonym ABG059
Chromosome	1H
Chromosome Arm	1HS
Map	[ Hide all but 1 of 7 ] Barley-Consensus-1H -36.2 Barley-consensus-2003-1H 6.8 Barley-Consensus2-1H 23.7 Hordeum-GxH-1H 4.89 Hordeum-KxM-1H 28.8 Hordeum-StMo-SNP-1H 20.4 Hv-Consensus2006-Marcel-1H 11.08
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 7 ]
Probe	ABG59
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Langridge, Peter J.
Remark	Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	ABG059
Probe	ABG59
Locus	ABG59 ABG059
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	TTCGGGTTGAGTCTGTTAGC GCCATCACGAGTTTAGTCTT
Sequence	L44043 ABG59
Source Species	Hordeum vulgare