Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG616

[Submit comment/correction]

Locus	ABG616
Type	RFLP STS
Chromosome	7H
Map	Barley-Consensus2-7H 33.3 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 6 ] Barley consensus 2 Barley, AxK Barley, BinMap 2005 Barley, Consensus 2023, FHB Barley, HxT Barley, Zhedar2, FHB QTL
Probe	ABG616
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Probe	ABG616
Locus	ABG616
Synonym	Synonym HAR35_15184
External Databases	DDBJ EMBL GenBank
Type	STS
PCR primers	CCCTCAAGGATGACTCTCTA GAGATGGTGTCGGAGCTTAG
Sequence	L44050 ABG616
Source Species	Hordeum vulgare