Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG62

[Submit comment/correction]

Locus	ABG62
Type	RFLP
Synonym	Synonym ABG062
Chromosome	6H
Chromosome Arm	6HS
Map	Barley-consensus-2003-6H 3 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] Barley consensus Barley consensus 2003 Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, CxH Barley, GxH Barley, KxM Barley, Steptoe x Morex, SNP
Probe	ABG62
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABG62 in the Barley, Consensus 2006 DArT maps = 1 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	ABG062 ABG062-6H
Probe	ABG62
Locus	ABG62 ABG062 ABG062-6H
Synonym	Synonym HAR35_42532
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	GTTTTGTCATTTTCTGTTCA GCATTTGTTCTAATTTCTCA
Sequence	L44078 ABG62
Source Species	Hordeum vulgare