Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG702

[Submit comment/correction]

Locus	ABG702
Type	RFLP
Synonym	Synonym ABG702a
Chromosome	1H
Chromosome Arm	1HL
Map	[ Hide all but 1 of 11 ] Barley-Consensus-1H 95 Barley-Consensus2-1H 133.7 Barley-ConsensusFHB-1H 130.99 Hordeum-Consensus2007-SSR-1H 118.97 Hordeum-Genes-1H -43.5 Hordeum-NABGMP1-1H 129.6 Hordeum-SxM-base-1H 130.5 Hordeum-SxM-FeedQTL-1H 129.6 Hordeum-SxM-SSAP-1H 126.6 Hv-Consensus2006-Marcel-1H 118.97 Hv-Integrated2009-1H 122.5
	[ Show Nearby Loci ]
QTL with Locus Marker	QABA.StMo-1H QBgnm.StMo-1H.2
Map Data	Barley consensus [ Show all 11 ]
Species	Hordeum vulgare
Probe	ABG702
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
Data Source	Blake, Tom 05.04.19
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABG702(A) ABG702(B) ABG702a ABG702B
Probe	ABG702
Locus	ABG702 ABG702B ABG702a ABG702(A) ABG702(B)
Synonym	Synonym HAR35_25320 HAR35_30748 HAR35_6023
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	TCATGTACGTCGGCCATCTC CCGAGAAAACATCAAACCTG
Sequence	L44085 ABG702
Source Species	Hordeum vulgare