Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG707

[Submit comment/correction]

Locus	ABG707
Type	RFLP STS
Synonym	Synonym ABG707
Chromosome	5H
Chromosome Arm	5HL
Map	[ Hide all but 1 of 11 ] Barley-Consensus-5H 101.4 Barley-Consensus2-5H 174.7 Hordeum-Bins-5H 176.9 Hordeum-Consensus2005-SNP-5H 173.327 Hordeum-NABGMP1-5H 180.2 Hordeum-QTLConsensus-Abiotic-5H 173.33 Hordeum-QTLConsensus-Agronomic-5H 173.33 Hordeum-StMo-SNP-5H 163.04 Hordeum-SxM-FeedQTL-5H 180.2 Hv-Consensus2006-Marcel-5H 159.41 Hv-Integrated2009-5H 156.7
	[ Show Nearby Loci ]
QTL with Locus Marker	QAa.StMo-5H.2 QBgsk.StMo-5H.2
Map Data	Barley consensus [ Show all 11 ]
Probe	ABG707
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	ABG707(A) ABG707(B) ABG707a ABG707B
Probe	ABG707
Locus	ABG707 ABG707B ABG707a ABG707(A) ABG707(B)
Synonym	Synonym HAR35_12982 HAR35_38351 HAR35_48455
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	TATAGCTTTTCCAGTGAATC TCCTCTCTTCCTCCCTCACC
Sequence	L44089 ABG707
Source Species	Hordeum vulgare