Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG708

[Submit comment/correction]

Locus	ABG708
Type	RFLP
Synonym	Synonym ABG708
Chromosome	5H
Chromosome Arm	5HS
Map	Barley-consensus-2003-5H 11.4 [ Show all 15 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 17 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, GxH Barley, HxT Barley, Integrated, Marcel 2009 Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Probe	ABG708
Reference	Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABG708 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Probe	ABG708
Locus	ABG708
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	GATAATTTCGTTGTTCTTCT CACAAGATCATCTACAAACT
Sequence	L44090 ABG708
Source Species	Hordeum vulgare