Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: BCD129

[Submit comment/correction]

Locus	BCD129
Type	RFLP
Synonym	Synonym BCD129
Chromosome	7H
Chromosome Arm	7HS
Map	Barley-consensus-2003-7H 17.9 [ Show all 19 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QNb.StMo-7H QTw.BlKy-7H.1
Map Data	[ Hide all but 1 of 19 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, CxH Barley, CxS Barley, HxT Barley, HxT basemap Barley, Integrated, Marcel 2009 Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Probe	BCD129
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Number of populations contributing to the placement of BCD129 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	Xbcd129 [ Show all 6 ]
Probe	BCD129
Locus	BCD129 [ Show all 7 ]
Reference	Heun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
Remarks	Lambda ZAP II library Bar.LambZAPII [c] Bar.LambZAPII
Type	cDNA STS
PCR primers	CAACAATATGGGCATTACAT CGAGGAGTTCTACAAATCAT
Sequence	L44096 BCD129
Polymorphism	BCD129 EcoRI
Linkage Group	[b 1S]
Insert Enzyme	EcoRI
Source Species	Hordeum vulgare
Source Germplasm	Willis
Source Tissue	etiolated leaf
Insert Size	2
PCR size	2