Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0018

[Submit comment/correction]

Locus	Bmac0018
Type	Microsatellite
Synonym	Synonym Bmac18
Chromosome	6H
Map	Barley, B73xCPI-6H 47.8 [ Show all 12 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_6H_9 QFhs.umn-6H .2
Map Data	[ Hide all but 1 of 12 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, B73xCPI Barley, Consensus 2005, SNP Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, Integrated, Marcel 2009 Barley, L94 x Vada, 2006 Barley, Lina x H.spont, SNP Barley, LxHs
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0018 Bmac18
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 7 ]
Possible Orthologs	Bmac18
Probe for Locus	Bmac18
Locus	Bmac0018 Bmac18
Synonym	Other name Bmac0018
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)11 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.59
Type	PCR SSR
PCR primers	5' GTCCTTTACGCATGAACCGT 3' 5' ACATACGCCAGACTCGTGTG 3'
SSR size	138
Amplification Conditions	1 cycle of 3 mins @ 94C, 1 min @ 66C, 1 min @ 72C, 5 cycles of 30 secs @ 94C, 30 secs @ 65C (decreasing 1C per cycle), 30 secs @ 72C, 24 cycles of 30 secs @ 94C, 30 secs @ 60C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare