Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0047b

[Submit comment/correction]

Locus	Bmac0047b
Type	Microsatellite
Synonym	Synonym Bmac47
Chromosome	4H 7H
Map	Barley-ConsensusFHB-4H 69.31 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 7 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, Consensus 2005, SNP Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, LxHs Barley, OWB, SNP
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0047 Bmac47
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AC)16 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmac0047 [ Show all 8 ]
Probe for Locus	Bmac0047
Locus	Bmac0047 [ Show all 6 ]
Synonym	Other name Bmac47
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	AACACACGTACACAAATACACA ACGTCCATCACTTTGACC