Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0134

[Submit comment/correction]

Locus	Bmac0134
Type	Microsatellite
Synonym	Synonym Bmac134 Bmac134a
Chromosome	2 (2H) 2H
Map	[ Hide all but 1 of 15 ] Barley, B73xCPI-4H 101 Barley-ConsensusFHB-2H 11.43 Hordeum-Consensus2005-SNP-2H 11.663 Hordeum-Consensus2007-SSR-2H 10.87 Hordeum-LiHs-SNP-2H 2.35 Hordeum-Lx41-2H 0 Hordeum-LxHs-2H 5 Hordeum-Pillen-2H 5 Hordeum-QTLConsensus-Abiotic-2H 11.66 Hordeum-QTLConsensus-Agronomic-2H 11.66 Hordeum-TxE-2H 9.6 Hv-Consensus2006-Marcel-2H 10.87 Hv-Integrated2009-2H 7.9 Hv-L94/Vada-2006-2H 1.44 Hv-Nure/Tremois-2H 3.1
	[ Show Nearby Loci ]
QTL with Locus Marker	QHea.pil-2H.1 QTgw.pil-2H.1
Map Data	Barley, Abiotic QTL Consensus [ Show all 16 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0134 Bmac134
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus position not reported in Cebada Capa x SusPtrit map [ Show all 8 ]
Possible Orthologs	Bmac134 Bmac134a Bmac134b
Probe for Locus	Bmac134
Locus	Bmac0134 Bmac134 Bmac134a Bmac134b
Synonym	Other name Bmac0134
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)28 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.76
Type	PCR SSR
PCR primers	5' CCAACTGAGTCGATCTCG 3' 5' CTTCGTTGCTTCTCTACCTT 3'
SSR size	148
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare