Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0144

[Submit comment/correction]

Locus	Bmac0144
Type	Microsatellite
Map	Barley, B73xCPI-1H 74.4
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI
Probe	Bmac0144
Possible Orthologs	Bmac144 [ Show all 13 ]
Probe	Bmac0144
Locus	[ Hide all but 1 of 13 ] Bmac0144 Bmac0144a Bmac0144g Bmac0144b Bmac0144d Bmac0144e Bmac0144c Bmac0144h Bmac0144f Bmac0144i Bmac0144k Bmac0144l Bmac0144j
Synonym	Other name Bmac144
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	TACGTGTACATACTCTACGATTTG ACTTATTCTGCATCCTGGGT