Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0167

[Submit comment/correction]

Locus	Bmac0167
Type	Microsatellite
Synonym	Synonym Bmac167
Chromosome	7H
Map	Barley, B73xCPI-7H 87 [ Show all 9 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 9 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, B73xCPI Barley, Consensus 2005, SNP Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, Lina x H.spont, SNP Barley, LxHs
Species	Hordeum vulgare
Probe	Bmac0167 Bmac167
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Igri x Franka, Lina x H. spontaneum Insert contains repeat AC)20 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmac167
Probe for Locus	Bmac167
Locus	Bmac0167 Bmac167
Synonym	Other name Bmac0167
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat AC)20 Quality = 2: Single product, relatively strong stutter bands Null in H. spontaneum Canada Park.
Type	PCR SSR
PCR primers	5' CATTTCCACTTCAAAATATCC 3' 5' CCAAAGTTTGAGTGCAGAC 3' CATTTCCACTTCAAAATATCC CCAAAGTTTGAGTGCAGAC
SSR size	184
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare