Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0181

[Submit comment/correction]

Locus	Bmac0181
Type	Microsatellite
Synonym	Synonym Bmac181
Chromosome	4H
Map	Barley, B73xCPI-4H 56.3 [ Show all 10 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 10 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, B73xCPI Barley, Consensus 2005, SNP Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, Lina x H.spont, SNP Barley, LxHs Barley, Zhedar2, FHB QTL
Species	Hordeum vulgare
Probe	Bmac0181 Bmac181
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmac181
Probe for Locus	Bmac181
Locus	Bmac0181 Bmac181
Synonym	Other name Bmac0181
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)20 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.75
Type	PCR SSR
PCR primers	5' ATAGATCACCAAGTGAACCAC 3' 5' GGTTATCACTGAGGCAAATAC 3' ATAGATCACCAAGTGAACCAC GGTTATCACTGAGGCAAATAC
SSR size	177
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare