Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0216

[Submit comment/correction]

Locus	Bmac0216
Type	Microsatellite
Synonym	Synonym Bmac216
Chromosome	2H
Map	Barley, B73xCPI-2H 84.2 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, B73xCPI Barley, Consensus 2005, SNP Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Lina x H.spont, SNP Barley, LxHs
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0216 Bmac216
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AC)5 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmac216
Probe for Locus	Bmac216
Locus	Bmac0216 Bmac216
Synonym	Other name Bmac0216
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)5 Quality = 4: Ladders of bands that are at equal intensity, but may contain scoreable weak products
Type	PCR SSR
PCR primers	5' GTACTATTCTTTGCTTGGGC 3' 5' ATACACATGTGCAAAACCATA 3'
SSR size	190
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare