Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0006

[Submit comment/correction]

Locus	Bmag0006
Type	Microsatellite
Synonym	Synonym Bmag6
Chromosome	3H
Map	[ Hide all but 1 of 6 ] Barley, B73xCPI-3H 46.1 Barley-ConsensusFHB-3H 57.19 Hordeum-Consensus2007-SSR-3H 50.14 Hordeum-LiHs-SNP-3H 41.38 Hordeum-LxHs-3H 54 Hv-Integrated2009-3H 61.7
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI [ Show all 6 ]
Species	Hordeum vulgare
Probe	Bmag0006 Bmag006 Bmag6
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmag006 Bmag6
Probe for Locus	Bmag006
Locus	Bmag0006
Synonym	Other name Bmag0006 Bmag6
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	TTAAACCCCCCCCCTCTAG TGCAGTTACTATCGCTGATTTAGC