Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0009

[Submit comment/correction]

Locus	Bmag0009
Type	Microsatellite
Synonym	Synonym Bmag9
Chromosome	6H
Map	[ Hide all but 1 of 18 ] Barley, B73xCPI-6H 47.8 Barley-ConsensusFHB-6H 59.5 Hordeum-Consensus2005-SNP-6H 72.109 Hordeum-Consensus2007-SSR-6H 62.21 Hordeum-LiHs-SNP-6H 18.64 Hordeum-LxHs-6H 103 Hordeum-OWB-2004-6H 66.8 Hordeum-OWB-2005-6H 70.9 Hordeum-OWB-6H 71.6 Hordeum-OWB-OPA2008-6H 67.419 Hordeum-OWB-SNP-6H 72.06 Hordeum-QTLConsensus-Abiotic-6H 72.11 Hordeum-QTLConsensus-Agronomic-6H 72.11 Hordeum-RxK-NTNB-6H 97.65 Hv-CebadaCapa/SusPtrit-6H 61.09 Hv-Integrated2009-6H 61.1 Hv-L94/Vada-2006-6H 60.75 Hv-Nure/Tremois-6H 48.3
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 18 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0009 Bmag9
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmag9 Bmag9a Bmag9b
Probe for Locus	Bmag9
Locus	Bmag0009 Bmag9 Bmag9a Bmag9b
Synonym	Other name Bmag0009
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AG)13 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.59
Type	PCR SSR
PCR primers	5' AAGTGAAGCAAGCAAACAAACA 3' 5' ATCCTTCCATATTTTGATTAGGCA 3'
SSR size	172
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare