Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0013

[Submit comment/correction]

Locus	Bmag0013
Type	Microsatellite
Synonym	Synonym Bmag13
Chromosome	3 (3H) 3H
Map	Barley, B73xCPI-3H 104.2 [ Show all 15 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_3H_5 MetaQ.HD_3H_1 QFhs.umn-3H.2 QHD.umn-3H
Map Data	Barley, Abiotic QTL Consensus [ Show all 15 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0013 Bmag13
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Oregon Wolfe Barleys,Cebada Capa x SusPtrit,Nure x Tremois Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : L94 x Vada, OWBrecessive x OWBdominant, Lina x H. spontaneum Insert contains repeat (CT)21 Polymorphic Information Content (PIC) = 0.72 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmag013 Bmag13
Probe for Locus	Bmag13
Locus	Bmag0013 Bmag13 Bmag013
Synonym	Other name Bmag0013
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (CT)21 Quality = 4: Ladders of bands that are at equal intensity, but may contain scoreable weak products Diversity Index (DI) = 0.72
Type	PCR SSR
PCR primers	5' AAGGGGAATCAAAATGGGAG 3' 5' TCGAATAGGTCTCCGAAGAAA 3'
SSR size	155
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare