Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0021

[Submit comment/correction]

Locus	Bmag0021
Type	Microsatellite
Synonym	Synonym Bmag21
Chromosome	7H
Map	Barley-ConsensusFHB-7H 14.69 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 8 ]
Species	Hordeum vulgare
Probe	Bmag021 Bmag21
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Igri x Franka, Lina x H. spontaneum Insert contains repeat (CA)10AA(GA)28 Polymorphic Information Content (PIC) = 0.78 Developing laboratory = SCRI (R. Waugh)
Probe for Locus	Bmag021
Locus	Bmag0021
Synonym	Other name Bmag21
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	ATTTTTATCAGAACGTCTCTCTC CTAACTTCTCTCTCCCTCTCC