Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0113a

[Submit comment/correction]

Locus	Bmag0113a
Type	Microsatellite
Synonym	Synonym Bmag113
Chromosome	1H 5H
Map	[ Hide all but 1 of 10 ] Barley-ConsensusFHB-5H 93.3 Hordeum-Consensus2005-SNP-5H 80.603 Hordeum-Consensus2007-SSR-5H 81.44 Hordeum-LiHs-SNP-5H 62.13 Hordeum-LxHs-5H 61 Hordeum-OWB-1H 88.3 Hordeum-OWB-2004-1H 85.3 Hordeum-OWB-SNP-1H 87.37 Hordeum-QTLConsensus-Abiotic-5H 80.6 Hordeum-QTLConsensus-Agronomic-5H 80.6
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 10 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0113 Bmag113
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AG)18 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmag0113 [ Show all 16 ]
Probe for Locus	Bmag0113
Locus	Bmag0113c [ Show all 9 ]
Synonym	Other name Bmag113
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	GGAATCTTCTGGAACGTC TTAAGAAGATCATTGTATTGAAGA