Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0125

[Submit comment/correction]

Locus	Bmag0125
Type	Microsatellite
Synonym	Synonym Bmag125
Chromosome	2 (2H) 2H
Map	Barley, B73xCPI-2H 90.5 [ Show all 19 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.DON_2H_24 MetaQ.FHB_2H_29 QDon.umn-2H.1 QFhs.umn-2H.3
Map Data	Barley, Abiotic QTL Consensus [ Show all 19 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0125 Bmag125
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka,Nure x Tremois Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : L94 x Vada, Steptoe x Morex, OWBrecessive x OWBdominant, Igri x Franka, Lina x H. spontaneum Insert contains repeat (AG)19 Polymorphic Information Content (PIC) = 0.76 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmag125
Probe for Locus	Bmag125
Locus	Bmag0125 Bmag125
Synonym	Other name Bmag0125
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AG)19 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.76
Type	PCR SSR
PCR primers	5' AATTAGCGAGAACAAAATCAC 3' 5' AGATAACGATGCACCACC 3'
SSR size	134
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare