Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0135

[Submit comment/correction]

Locus	Bmag0135
Type	Microsatellite
Chromosome	1 (7H) 7H
Map	Barley, B73xCPI-7H 182.4 [ Show all 9 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHei.pil-7H.7 QTgw.pil-7H.2
Map Data	[ Hide all but 1 of 9 ] Barley, AxHs/QTL Barley, B73xCPI Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, L94 x Vada, 2006 Barley, LxHs Barley, Nure x Tremois Barley, TxE
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0135 Bmag135
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Probe for Locus	Bmag135
Locus	Bmag0135 Bmag135 Bmag135a Bmag135b
Synonym	Other name Bmag0135 Bmag135
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AG)10GG(AG)12 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.87
Type	PCR SSR
PCR primers	5' ACGAAAGAGTTACAACGGATA 3' 5' GTTTACCACAGATCTACAGGTG 3'
SSR size	161
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare