Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0337

[Submit comment/correction]

Locus	Bmag0337
Type	Microsatellite
Synonym	Synonym Bmag337
Chromosome	5H
Map	[ Hide all but 1 of 11 ] Barley, B73xCPI-5H 52.5 Barley-ConsensusFHB-5H 66.29 Hordeum-Consensus2005-SNP-5H 60.893 Hordeum-Consensus2007-SSR-5H 44.99 Hordeum-CxB-5H 13.1 Hordeum-FxS-FHB-QTL-5H 80.8 Hordeum-LiHs-SNP-5H 36.44 Hordeum-LxHs-5H 35 Hordeum-Pillen-5H 35 Hordeum-QTLConsensus-Abiotic-5H 60.89 Hordeum-QTLConsensus-Agronomic-5H 60.89
	[ Show Nearby Loci ]
QTL with Locus Marker	QTgw.pil-5H.1
Map Data	Barley, Abiotic QTL Consensus [ Show all 11 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0337 Bmag337
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AG)22 Polymorphic Information Content (PIC) = 0.67 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmag337
Probe for Locus	Bmag337
Locus	Bmag0337 Bmag337
Synonym	Other name Bmag0337
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AG)22 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.67
Type	PCR SSR
PCR primers	5' ACAAAGAGGGAGTAGTACGC 3' 5' GACCCATGATATATGAAGATCA 3'
SSR size	145
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare