Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0353

[Submit comment/correction]

Locus	Bmag0353
Type	Microsatellite
Synonym	Synonym Bmag353
Chromosome	4 (4H) 4H
Map	[ Hide all but 1 of 17 ] Barley, B73xCPI-4H 64.6 Barley-ConsensusFHB-4H 75.2 Hordeum-Consensus2005-SNP-4H 63.184 Hordeum-Consensus2007-SSR-4H 65.01 Hordeum-Lx41-4H 74.2 Hordeum-LxHs-4H 45 Hordeum-OWB-2004-4H 60.5 Hordeum-OWB-2005-4H 61.6 Hordeum-OWB-4H 65.2 Hordeum-OWB-OPA2008-4H 63.31 Hordeum-OWB-SNP-4H 66.21 Hordeum-Pillen-4H 45 Hordeum-QTLConsensus-Abiotic-4H 63.18 Hordeum-QTLConsensus-Agronomic-4H 63.18 Hordeum-TxE-4H 86.8 Hv-Integrated2009-4H 74.6 Hv-L94/Vada-2006-4H 37.72
	[ Show Nearby Loci ]
QTL with Locus Marker	QHei.pil-4H.3 QTgw.pil-4H.3
Map Data	Barley, Abiotic QTL Consensus [ Show all 17 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0353 Bmag353
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmag353
Probe for Locus	Bmag353
Locus	Bmag0353 Bmag353
Synonym	Other name Bmag0353
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AG)21 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.67
Type	PCR SSR
PCR primers	5' ACTAGTACCCACTATGCACGA 3' 5' ACGTTCATTAAAATCACAACTG 3'
SSR size	119
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare