Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0490

[Submit comment/correction]

Locus	Bmag0490
Type	Microsatellite
Chromosome	4H
Map	Barley, B73xCPI-4H 60.4 Barley-ConsensusFHB-4H 75.2 Hordeum-Consensus2007-SSR-4H 62.19 Hordeum-LxHs-4H 52 Hv-Integrated2009-4H 72.4
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, LxHs
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0490 Bmag490
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Steptoe x Morex, Lina x H. spontaneum Insert contains repeat (AG)24 Polymorphic Information Content (PIC) = 0.73 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmag490
Probe for Locus	Bmag490
Locus	Bmag0490 Bmag490
Synonym	Other name Bmag0490
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AG)24 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.73
Type	PCR SSR
PCR primers	5' TGATACATCAAGATCGTGACA 3' 5' GGGACTGAGTGTATGAATGAG 3' TGATACATCAAGATCGTGACA GGGACTGAGTGTATGAATGAG
SSR size	121
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare