Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0500

[Submit comment/correction]

Locus	Bmag0500
Type	Microsatellite
Synonym	Synonym Bmag500
Chromosome	6H
Map	Barley, B73xCPI-6H 23.8 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 6 ] Barley, B73xCPI Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, Integrated, Marcel 2009 Barley, LxHs
Species	Hordeum vulgare
Probe	Bmag0500 Bmag500
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmag500 Bmag507 Bmag507-7H Xmag500.1 Xmag500.2
Probe for Locus	Bmag500
Locus	Bmag0500 Bmag500
Synonym	Other name Bmag0500
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AG)6CG(AG)29(AGAGGG)3(AG)6 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.8
Type	PCR SSR
PCR primers	5' GGGAACTTGCTAATGAAGAG 3' 5' AATGTAAGGGAGTGTCCATAG 3' GGGAACTTGCTAATGAAGAG AATGTAAGGGAGTGTCCATAG
SSR size	150
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare