Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0692

[Submit comment/correction]

Locus	Bmag0692
Type	Microsatellite
Synonym	Synonym Bmag692
Chromosome	2H
Map	[ Hide all but 1 of 9 ] Barley, B73xCPI-2H 44.9 Barley-ConsensusFHB-2H 52.13 Hordeum-Consensus2005-SNP-2H 86.6 Hordeum-Consensus2007-SSR-2H 46.23 Hordeum-LiHs-SNP-2H 35.74 Hordeum-LxHs-2H 63 Hordeum-QTLConsensus-Abiotic-2H 86.6 Hordeum-QTLConsensus-Agronomic-2H 86.6 Hv-Integrated2009-2H 35.8
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 9 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0692 Bmag692
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmag692
Probe for Locus	Bmag692
Locus	Bmag0692 Bmag692
Synonym	Other name Bmag0692
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (CT)19 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.72
Type	PCR SSR
PCR primers	5' GCAAGGTATCTCTTGTATTTTG 3' 5' TGGCATCTACAATCTAAAACA 3'
SSR size	182
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare