Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: G062f

[Submit comment/correction]

Locus	G062f
Type	RFLP
Map	Tt-Gill-3D 342
	[ Show Nearby Loci ]
Map Data	T.tauschii
Probe	pTtksuG62
Possible Orthologs	[ Hide all but 1 of 12 ] G062a G062b G062d G062e G062g G062h G062i G062j ksuG62 XksuG62 XksuG62-3B XksuG62-3R
Probe for Locus	pTtksuG62
Locus	ksuG62 [ Show all 15 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	L:TTAGAAGCAGGCTATGACCA R:TACCATCAAGACGCCAGAAG
Linkage Group	3D (9)
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	0.7