Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBM1075

[Submit comment/correction]

Locus	GBM1075
Type	Microsatellite
Chromosome	6H
Map	Barley, B73xCPI-6H 43.7 Barley-ConsensusFHB-6H 53.47 Hordeum-Consensus2007-SSR-6H 50.08 Hordeum-RxK-NTNB-6H 82 Hv-Integrated2009-6H 49.3
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, Rika/Kombar NTNB, 6H
Species	Hordeum vulgare
Probe	GBM1075
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Thiel T et al. (2003) Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.) Theoretical and Applied Genetics 106:411-422.
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Igri x Franka Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : OWBrecessive x OWBdominant, Igri x Franka Insert contains repeat (GT)6 Polymorphic Information Content (PIC) = 0.72 Developing laboratory = IPK (A. Graner)
Probe	GBM1075
Locus	GBM1075 GBM1075-6H
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Stein N et al. (2007) A 1000 loci transcript map of the barley genome - new anchoring points for integrative grass genomics Theoretical and Applied Genetics 114:823-839. Thiel T et al. (2003) Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.) Theoretical and Applied Genetics 106:411-422.
Remarks	Primer sequences for this SSR are proprietary, those interested should contact Andreas Graner Clone HW02M04T
Type	SSR
PCR primers	CCCGACCAAGCTTTTCTCAC TGATGGTGGGCTTCTTGTTG available upon request to authors: graner@ipk-gatersleben.deGBM1076 PCR_primers
Amplification Conditions	3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	AL503602
DNA Library	IPK-HW
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)