Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBM1110

[Submit comment/correction]

Locus	GBM1110
Type	Microsatellite
Chromosome	3H
Map	Barley, B73xCPI-3H 48.8 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI [ Show all 6 ]
Species	Hordeum vulgare
Probe	GBM1110
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remark	[ Hide all but 1 of 7 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Steptoe x Morex,Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : L94 x Vada, Steptoe x Morex, OWBrecessive x OWBdominant Insert contains repeat (AAG)6 Polymorphic Information Content (PIC) = 0.61 Developing laboratory = IPK (A. Graner)
Probe	GBM1110
Locus	GBM1110 GBM1110-3H
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remarks	Primer sequences for this SSR to be released in the public domain soon (noted: September 2006). Those interested should contact Andreas Graner Clone HI01I17w
Type	SSR EST
PCR primers	CACCGAAGAAAATCCACCAT CACGCAAGCTTAGAACCTCC
Amplification Conditions	3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	BQ660218
DNA Library	IPK-HI
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)