Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBM1140

[Submit comment/correction]

Locus	GBM1140
Type	Microsatellite
Chromosome	6H
Map	Barley-ConsensusFHB-6H 94.58 Hordeum-Consensus2007-SSR-6H 97.31 Hv-Integrated2009-6H 97.7
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009
Species	Hordeum vulgare
Probe	GBM1140
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Igri x Franka Insert contains repeat (ATC)5 Polymorphic Information Content (PIC) = 0.24 Developing laboratory = IPK (A. Graner)
Probe	GBM1140
Locus	GBM1140 GBM1140-6H
Reference	Hayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remarks	Clone HP01D04w
Type	SSR
PCR primers	Forward TGACCGGATCAAACCTCTTC Reverse TAGCATGAACAAAACCGACG TGACCGGATCAAACCTCTTC TAGCATGAACAAAACCGACG
Amplification Conditions	3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	BQ661765
DNA Library	IPK-HP
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)