Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GBM1412

[Submit comment/correction]

Locus	GBM1412
Type	Microsatellite
Chromosome	1H
Map	Barley-ConsensusFHB-1H 60.05 Hordeum-Consensus2007-SSR-1H 59.11 Hv-Consensus2006-Marcel-1H 59.11 Hv-Integrated2009-1H 59.3
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, Vada x SusPtrit
Species	Hordeum vulgare
Probe	GBM1412
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Remark	[ Hide all but 1 of 8 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Vada x SusPtrit Map position not determined on Vada x SusPtrit map Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Vada x SusPtrit Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : SusPtrit x Vada Insert contains repeat (AGTAG)6 Polymorphic Information Content (PIC) = 0.44 Developing laboratory = WUR (R. Niks)
Probe	GBM1412
Locus	GBM1412
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
Remarks	Primer sequences for this Microsatellite to be released in the public domain soon (noted: September 2006). Those interested should contact Andreas Graner
Type	PCR SSR
PCR primers	TCGACACAGATAGACAGGCG GACGGAGCCAACCAATAAAA
Source Species	Hordeum vulgare